lenti SYN-SVI-DIO-dCas9-KRAB-MeCP2
(Plasmid
#170378)
-
PurposeExpresses a SYN-driven, intron-containing dCas9-KRAB-MeCP2 fusion in which the part of the dCas9 cassette is double floxed and in inverted orientation (DIO). Requires Cre-dependent recombination.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170378 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang Addgene plasmid #52961
- Backbone size w/o insert (bp) 7546
- Total vector size (bp) 13818
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameA DIO FLAG-dCas9-KRAB-MeCP2 cassette containing an SV40 intron
-
SpeciesSynthetic
-
Insert Size (bp)5812
- Promoter human Synapsin promoter
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTATTACAGGGACAGCAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bydCas9-KRAB-MeCP2 was a gift from Alejandro Chavez & George Church (Addgene plasmid # 110821 ; http://n2t.net/addgene:110821 ; RRID:Addgene_110821)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti SYN-SVI-DIO-dCas9-KRAB-MeCP2 was a gift from Jeremy Day (Addgene plasmid # 170378 ; http://n2t.net/addgene:170378 ; RRID:Addgene_170378) -
For your References section:
A Cre-dependent CRISPR/dCas9 system for gene expression regulation in neurons. Carullo NVN, Hinds JE, Revanna JS, Tuscher JJ, Bauman AJ, Day JJ. eNeuro. 2021 Jul 26. pii: ENEURO.0188-21.2021. doi: 10.1523/ENEURO.0188-21.2021. 10.1523/ENEURO.0188-21.2021 PubMed 34321217