Skip to main content
Addgene

pCMV-SARS2SΔC-H2gp41
(Plasmid #170389)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 170389 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4971
  • Total vector size (bp) 8736
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Spike
  • Species
    SARS-CoV-2
  • Insert Size (bp)
    3765
  • Mutation
    Deletion of C terminal and fusion with H2 from HIV gp41
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CMV
  • Tag / Fusion Protein
    • HIV gp41 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tggctggcgtggaaatattc
  • 3′ sequencing primer tgagcatggtatcacaagttga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-SARS2SΔC-H2gp41 was a gift from Nir Hacohen (Addgene plasmid # 170389 ; http://n2t.net/addgene:170389 ; RRID:Addgene_170389)
  • For your References section:

    Longitudinal proteomic analysis of severe COVID-19 reveals survival-associated signatures, tissue-specific cell death, and cell-cell interactions. Filbin MR, Mehta A, Schneider AM, Kays KR, Guess JR, Gentili M, Fenyves BG, Charland NC, Gonye ALK, Gushterova I, Khanna HK, LaSalle TJ, Lavin-Parsons KM, Lilley BM, Lodenstein CL, Manakongtreecheep K, Margolin JD, McKaig BN, Rojas-Lopez M, Russo BC, Sharma N, Tantivit J, Thomas MF, Gerszten RE, Heimberg GS, Hoover PJ, Lieb DJ, Lin B, Ngo D, Pelka K, Reyes M, Smillie CS, Waghray A, Wood TE, Zajac AS, Jennings LL, Grundberg I, Bhattacharyya RP, Parry BA, Villani AC, Sade-Feldman M, Hacohen N, Goldberg MB. Cell Rep Med. 2021 May 18;2(5):100287. doi: 10.1016/j.xcrm.2021.100287. Epub 2021 May 3. 10.1016/j.xcrm.2021.100287 PubMed 33969320