pLV.EF1α.mEmerald.CD9.miR9T
(Plasmid #170452)

• Purpose: Lentiviral plasmid that encodes mEmerald-CD9 fusion protein with microRNA 9 tandem cassette to restrict expression to microglia with EF1-alpha promoter.
• Depositing Lab: Tsuneya Ikezu
• Publication: Clayton et al Mol Neurodegener. 2021 Mar 22;16(1):18. doi: 10.1186/s13024-021-00440-9.

Backbone

• Vector backbone: pLV
• Backbone size w/o insert (bp): 6681
• Total vector size (bp): 9305
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CD9
• Species: H. sapiens (human)
• Insert Size (bp): 1431
• GenBank ID: NM_001769.4 NM_001330312.2
• Entrez Gene: CD9 (a.k.a. BTCC-1, DRAP-27, MIC3, MRP-1, TSPAN-29, TSPAN29)
• Promoter: EF1a
• Tag / Fusion Protein:
  • mEmerald (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PspXI (unknown if destroyed)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: cctttcgtcttcactcgaggtgcccgtca
• 3′ sequencing primer: gaattctgcagtcgacaatcaacc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Michael Davidson (Addgene plasmid # 54029)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry