Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLV.EF1α.mEmerald.CD9.miR9T
(Plasmid #170452)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 170452 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLV
  • Backbone size w/o insert (bp) 6681
  • Total vector size (bp) 9305
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1431
  • GenBank ID
    NM_001769.4 NM_001330312.2
  • Entrez Gene
    CD9 (a.k.a. BTCC-1, DRAP-27, MIC3, MRP-1, TSPAN-29, TSPAN29)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mEmerald (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PspXI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer cctttcgtcttcactcgaggtgcccgtca
  • 3′ sequencing primer gaattctgcagtcgacaatcaacc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Michael Davidson (Addgene plasmid # 54029)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV.EF1α.mEmerald.CD9.miR9T was a gift from Tsuneya Ikezu (Addgene plasmid # 170452 ; http://n2t.net/addgene:170452 ; RRID:Addgene_170452)
  • For your References section:

    Plaque associated microglia hyper-secrete extracellular vesicles and accelerate tau propagation in a humanized APP mouse model. Clayton K, Delpech JC, Herron S, Iwahara N, Ericsson M, Saito T, Saido TC, Ikezu S, Ikezu T. Mol Neurodegener. 2021 Mar 22;16(1):18. doi: 10.1186/s13024-021-00440-9. 10.1186/s13024-021-00440-9 PubMed 33752701