Skip to main content
Addgene

LentiGuide Cherry
(Plasmid #170510)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170510 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiGuide-Puro
  • Backbone manufacturer
    Feng Zhang lab (Addgene plasmid #52963)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    S. pyogenes sgRNA cassette
  • Alt name
    S. pyogenes CRISPR customizable RNA element
  • Species
    Synthetic
  • Insert Size (bp)
    100
  • Promoter hU6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (not destroyed)
  • 3′ cloning site BsmBI (not destroyed)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    698
  • Promoter EF-1a

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer tggttcattctcaagcctcag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    CRISPR cassette generated by Feng Zhang
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid based on lentiGuide Puro (addgene plasmid #52963).

Please visit https://www.biorxiv.org/content/10.1101/2021.03.02.433398v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiGuide Cherry was a gift from Pavel Tolar (Addgene plasmid # 170510 ; http://n2t.net/addgene:170510 ; RRID:Addgene_170510)
  • For your References section:

    Genome-wide screens identify calcium signaling as a key regulator of IgE+ plasma cell differentiation and survival. Newman R, Tolar P. biorXiv 2021.03.02.433398 10.1101/2021.03.02.433398