Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pW301-lenti-spsgRNA-hsITGB1-pEF1s-NLS-mNeonGreen-P2A-BlastR
(Plasmid #170817)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 170817 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pW211 (Addgene #170809)
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-mNeonGreen-P2A-BlastR
  • gRNA/shRNA sequence
    GGACGCCGCGCGGAAAAGGT
  • Species
    B. lanceolatum; Synthetic; B. coriaceae
  • Insert Size (bp)
    1221
  • Mutation
    NA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

3rd generation lentiviral backbone. Please visit https://www.biorxiv.org/content/10.1101/2020.06.24.165795v2.full for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pW301-lenti-spsgRNA-hsITGB1-pEF1s-NLS-mNeonGreen-P2A-BlastR was a gift from Kenneth Yamada (Addgene plasmid # 170817 ; http://n2t.net/addgene:170817 ; RRID:Addgene_170817)
  • For your References section:

    Budding epithelial morphogenesis driven by cell-matrix versus cell-cell adhesion. Wang S, Matsumoto K, Lish SR, Cartagena-Rivera AX, Yamada KM. Cell. 2021 Jul 8;184(14):3702-3716.e30. doi: 10.1016/j.cell.2021.05.015. Epub 2021 Jun 15. 10.1016/j.cell.2021.05.015 PubMed 34133940