Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMSCVhyg-3xT7-nSREBP1a
(Plasmid #171030)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171030 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMSCVhyg-3xT7
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 8200
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    nSREBP1a
  • Alt name
    Srebf1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1200
  • Mutation
    amino acids 1- 449
  • Entrez Gene
    Srebf1 (a.k.a. ADD1, SREBP1, bHLHd1)
  • Promoter 5' LTR
  • Tag / Fusion Protein
    • 3xT7 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCVhyg-3xT7-nSREBP1a was a gift from Kai Ge (Addgene plasmid # 171030 ; http://n2t.net/addgene:171030 ; RRID:Addgene_171030)
  • For your References section:

    MED1 is a lipogenesis coactivator required for postnatal adipose expansion. Jang Y, Park YK, Lee JE, Wan D, Tran N, Gavrilova O, Ge K. Genes Dev. 2021 Apr 22. pii: gad.347583.120. doi: 10.1101/gad.347583.120. 10.1101/gad.347583.120 PubMed 33888555