pYL214
(Plasmid
#171031)
-
PurposeCRISPR plasmids encodes Cas9 and a sgRNA targeting EZH2 exon 2 - intron 2 junction (sequence: GCAGACGAGCTGATGAAGTAA)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171031 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEZH2
-
gRNA/shRNA sequenceGCAGACGAGCTGATGAAGTAA
-
SpeciesH. sapiens (human)
-
Entrez GeneEZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYL214 was a gift from Thomas Cech (Addgene plasmid # 171031 ; http://n2t.net/addgene:171031 ; RRID:Addgene_171031) -
For your References section:
RNA is essential for PRC2 chromatin occupancy and function in human pluripotent stem cells. Long Y, Hwang T, Gooding AR, Goodrich KJ, Rinn JL, Cech TR. Nat Genet. 2020 Sep;52(9):931-938. doi: 10.1038/s41588-020-0662-x. Epub 2020 Jul 6. 10.1038/s41588-020-0662-x PubMed 32632336