pRF TpC hTERT intron-1
(Plasmid
#171070)
-
PurposeFirefly-Renilla luciferase assay for hTERT promoter activity of hTERT intron-1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171070 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRF TpC
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehTERT intron-1
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aatgggaaaatatatcaaatcg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRF TpC hTERT intron-1 was a gift from Agnel Sfeir (Addgene plasmid # 171070 ; http://n2t.net/addgene:171070 ; RRID:Addgene_171070) -
For your References section:
Alternative splicing is a developmental switch for hTERT expression. Penev A, Bazley A, Shen M, Boeke JD, Savage SA, Sfeir A. Mol Cell. 2021 Apr 6. pii: S1097-2765(21)00228-8. doi: 10.1016/j.molcel.2021.03.033. 10.1016/j.molcel.2021.03.033 PubMed 33852895