pTUB1-Spy.dCas9-CAT-U6-sgRNA(decoy)
(Plasmid #171089)

• Purpose: CRISPR interference. Construct for expressing catalytically inactive Cas9 (dCas9) from Streptococcus pyogenes in Toxoplasma gondii. Suitable for generating stable cell lines.
• Depositing Lab: Sebastian Lourido
• Publication: Markus et al mSphere. 2021 Oct 13:e0047421. doi: 10.1128/mSphere.00474-21.

Backbone

• Vector backbone: pX330
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 9826
• Vector type: CRISPR ; Toxoplasma gondii expression
• Selectable markers: Chloramphenicol

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Decoy sgRNA
• Alt name: sgRNA NHE1 3′UTR
• Alt name: sgRNA#1
• Species: Synthetic; Streptococcus pyogenes, Toxoplasma gondii
• Insert Size (bp): 97
• Promoter: U6 (Toxoplasma gondii)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: ccggccgactctaaataggag
• 3′ sequencing primer: gcgggacatgcatggtac

Gene/Insert 2

• Gene/Insert name: dCas9
• Alt name: Spy.dCas9
• Alt name: Streptococcus pyogenes dCas9
• Species: Synthetic; originally from Streptococcus pyogenes, human codon-optimized
• Insert Size (bp): 4101
• Mutation: D10A, H840A
• Promoter: TUB1 (Toxoplasma gondii)
• Tags / Fusion Proteins:
  • 3X FLAG (N terminal on backbone)
  • Nuclear Localization Signal (N terminal on backbone)
  • Nuclear Localization Signal (C terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: aacccgcgcagaagacatcc
• 3′ sequencing primer: aacttcctgtacctggccagc

Gene/Insert 3

• Gene/Insert name: Chloramphenicol acetyltransferase
• Alt name: CAT
• Species: Shigella flexneri
• Insert Size (bp): 657
• Promoter: TUB1 (Toxoplasma gondii)

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: PciI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cgtaacacgccacatcttgc
• 3′ sequencing primer: gtgttcacccttgttacaccg

Resource Information

• Supplemental Documents:
  • pTUB1-Spy.dCas9-CAT-U6-sgRNA(decoy).gb
• A portion of this plasmid was derived from a plasmid made by: This plasmid was adapted from a construct previously published by Saima Sidik et al. (Addgene plasmid # 80323 ; A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Sidik SM, Huet D, Ganesan SM, Huynh MH, Wang T, Nasamu AS, Thiru P, Saeij JP, Carruthers VB, Niles JC, Lourido S. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. 10.1016/j.cell.2016.08.019 PubMed 27594426)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry