Skip to main content

pTUB1-Sth.dCas9-P2A-CAT-T2A-TagBFP
(Plasmid #171090)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171090 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 8529
  • Vector type
    CRISPR ; Toxoplasma gondii expression
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Sth1 dCas9
  • Alt name
    Streptococcus thermophilus CRISPR1 dCas9
  • Species
    Streptococcus thermophilus
  • Insert Size (bp)
    3363
  • Mutation
    D9A, H599A
  • Promoter TUB1 (Toxoplasma gondii)
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • SV40 NLS (N terminal on insert)
    • nucleoplasmin NLS (C terminal on insert)
    • P2A peptide (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tggtgatcctggttggaccg
  • 3′ sequencing primer cgtaacacgccacatcttgc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Chloramphenicol acetyltransferase
  • Alt name
    CAT
  • Species
    Shigella flexneri
  • Insert Size (bp)
    660
  • Promoter transcriptionally linked to Sth1 dCas9 via P2A peptide
  • Tag / Fusion Protein
    • T2A peptide (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgtaacacgccacatcttgc
  • 3′ sequencing primer gtgttcacccttgttacaccg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    TagBFP
  • Alt name
    monomeric blue fluorescent protein
  • Insert Size (bp)
    702
  • Promoter transcriptionally linked to CAT via T2A peptide

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtgttcacccttgttacaccg
  • 3′ sequencing primer caatcgttcgcggtgaagag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Sth1 dCas9 insert was cloned from a previously published plasmid, which was kindly provided to us by Jeremy Rock and Sarah Fortune. Rock JM, Hopkins FF, Chavez A, et al. Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform. Nat Microbiol. 2017;2:16274. Published 2017 Feb 6. doi:10.1038/nmicrobiol.2016.274

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTUB1-Sth.dCas9-P2A-CAT-T2A-TagBFP was a gift from Sebastian Lourido (Addgene plasmid # 171090 ; http://n2t.net/addgene:171090 ; RRID:Addgene_171090)
  • For your References section:

    CRISPR-Mediated Transcriptional Repression in Toxoplasma gondii. Markus BM, Boydston EA, Lourido S. mSphere. 2021 Oct 13:e0047421. doi: 10.1128/mSphere.00474-21. 10.1128/mSphere.00474-21 PubMed 34643425