pAAV gfaABC1D NES-jRCaMP1a
(Plasmid
#171120)
-
PurposeAstrocyte AAV-mediated expression of jRCaMP1a, a red fluorescent calcium sensor protein.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171120 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5039
- Total vector size (bp) 6448
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namejRCaMP1a
-
Alt nameRCaMP1h variant 1488
-
SpeciesSynthetic
-
Insert Size (bp)1409
- Promoter gfaABC1D
-
Tag
/ Fusion Protein
- His Tag, T7 Tag, XpressTag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGTCGTGAGGCACTGGGCAG
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byjRCaMP1a is from Douglas Kim, GENIE Project Addgene ID #61562 The promotor is from Baljit Khakh Addgene ID #52925,
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV gfaABC1D NES-jRCaMP1a was a gift from Thomas Oertner (Addgene plasmid # 171120 ; http://n2t.net/addgene:171120 ; RRID:Addgene_171120) -
For your References section:
Using Genetically Encoded Calcium Indicators to Study Astrocyte Physiology: A Field Guide. Lohr C, Beiersdorfer A, Fischer T, Hirnet D, Rotermund N, Sauer J, Schulz K, Gee CE. Front Cell Neurosci. 2021 Jun 11;15:690147. doi: 10.3389/fncel.2021.690147. eCollection 2021. 10.3389/fncel.2021.690147 PubMed 34177468