Skip to main content

pPPC001
(Plasmid #171138)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171138 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC18TminiTn7T-Gm
  • Backbone manufacturer
    Herbert Schweizer
  • Backbone size w/o insert (bp) 4569
  • Total vector size (bp) 10153
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Also resistant to Ampicillin
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
  • Species
    S. pyogenes (dCas9), MS2 (MCP), E. coli (SoxS)
  • Insert Size (bp)
    5642
  • Mutation
    SoxS has R93A and S101A mutations
  • Promoter Sp.pCas9, BBa_J23107

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer accgaacaggcttatgtcaa
  • 3′ sequencing primer caactattttgtccgcccaca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternative names: pCDP041, pUC18TminiTn7T-Gm_Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A/S101A)
Used for conjugation, with pTNS1 and pRK2013 helper plasmids, to integrate Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) cassettes into gram-negative bacteria.

Point mutation in the FRT site was observed and remained applicable with counterselection by pCK255

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPPC001 was a gift from Jesse Zalatan (Addgene plasmid # 171138 ; http://n2t.net/addgene:171138 ; RRID:Addgene_171138)
  • For your References section:

    Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida. Kiattisewee C, Dong C, Fontana J, Sugianto W, Peralta-Yahya P, Carothers JM, Zalatan JG. Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002. 10.1016/j.ymben.2021.04.002 PubMed 33930546