pCK255
(Plasmid
#171155)
-
PurposeExpression of I-SceI gene for genome engineering in Pseudomonas with sacB gene included for counterselection with sucrose on pBBR1-GmR plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBBR1-MCS5
-
Backbone manufacturerKenneth M. Peterson
- Backbone size w/o insert (bp) 4768
- Total vector size (bp) 8020
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMedium Copy in P. putida
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameI-SceI_sacB
-
SpeciesSynthetic
-
Insert Size (bp)3256
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggggagaggcggtttgcgta
- 3′ sequencing primer cgtttgtgatggcttccatg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPablo Ivan Nikel, Herbert Schweizer
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternative names: pBBR1-GmR_I-SceI_sacB
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCK255 was a gift from Jesse Zalatan (Addgene plasmid # 171155 ; http://n2t.net/addgene:171155 ; RRID:Addgene_171155) -
For your References section:
Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida. Kiattisewee C, Dong C, Fontana J, Sugianto W, Peralta-Yahya P, Carothers JM, Zalatan JG. Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002. 10.1016/j.ymben.2021.04.002 PubMed 33930546