Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #138709)


Item Catalog # Description Quantity Price (USD)
Plasmid 138709 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Standard European Vector Architecture
  • Backbone size w/o insert (bp) 3882
  • Total vector size (bp) 8506
  • Modifications to backbone
    tracrRNA-Cas9 was PCR amplified from pCas9 (Jiang et al, Nat Biotechnol 2013, 31, 233-239) and the 4.7 Kb fragment was cloned by Gibson Assembly in pSEVA421 restricted with SanDI/SwaI
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin and Streptomycin
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaacgctcggttgccgc
  • 3′ sequencing primer ctgcgtaacatcgttgctgctcca
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Aparicio T, de Lorenzo V, Martínez-García E (2018) CRISPR/Cas9-based counterselection boosts recombineering efficiency in Pseudomonas putida. Biotechnol J 13(5):1700161
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSEVA421-Cas9tr was a gift from Víctor de Lorenzo (Addgene plasmid # 138709 ; ; RRID:Addgene_138709)
  • For your References section:

    Recombination-Independent Genome Editing through CRISPR/Cas9-Enhanced TargeTron Delivery. Velazquez E, Lorenzo V, Al-Ramahi Y. ACS Synth Biol. 2019 Sep 20;8(9):2186-2193. doi: 10.1021/acssynbio.9b00293. Epub 2019 Sep 3. 10.1021/acssynbio.9b00293 PubMed 31419111