Skip to main content

pTarget12f1
(Plasmid #171183)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171183 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTargetF
  • Backbone size w/o insert (bp) 2014
  • Total vector size (bp) 2217
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA scaffold in the CRISPR/Cas12f1 system
  • gRNA/shRNA sequence
    tgcaccgtgtctagctagct
  • Species
    Synthetic
  • Promoter J23119(SpeI) promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTCCTTACGCATCTGTGCG
  • 3′ sequencing primer GATCAACGGCACTGTTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTarget12f1 was a gift from Kohsuke Honda (Addgene plasmid # 171183 ; http://n2t.net/addgene:171183 ; RRID:Addgene_171183)
  • For your References section:

    Genome editing by miniature CRISPR/Cas12f1 enzyme in Escherichia coli. Okano K, Sato Y, Hizume T, Honda K. J Biosci Bioeng. 2021 Aug;132(2):120-124. doi: 10.1016/j.jbiosc.2021.04.009. Epub 2021 May 19. 10.1016/j.jbiosc.2021.04.009 PubMed 34023220