pTarget12f1
(Plasmid
#171183)
-
PurposeConstitutive expression of sgRNA without donor DNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171183 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTargetF
- Backbone size w/o insert (bp) 2014
- Total vector size (bp) 2217
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA scaffold in the CRISPR/Cas12f1 system
-
gRNA/shRNA sequencetgcaccgtgtctagctagct
-
SpeciesSynthetic
- Promoter J23119(SpeI) promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTCCTTACGCATCTGTGCG
- 3′ sequencing primer GATCAACGGCACTGTTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTarget12f1 was a gift from Kohsuke Honda (Addgene plasmid # 171183 ; http://n2t.net/addgene:171183 ; RRID:Addgene_171183) -
For your References section:
Genome editing by miniature CRISPR/Cas12f1 enzyme in Escherichia coli. Okano K, Sato Y, Hizume T, Honda K. J Biosci Bioeng. 2021 Aug;132(2):120-124. doi: 10.1016/j.jbiosc.2021.04.009. Epub 2021 May 19. 10.1016/j.jbiosc.2021.04.009 PubMed 34023220