pGEMHE-mClover3-MAP4-MTBD
(Plasmid
#171498)
-
PurposeT7 promotor drives in vitro transcription of mClover3-tagged mouse MAP4-Microtubule Binding Domain mRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEHME
-
Vector typepGEHME
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAP4-MTBD
-
SpeciesM. musculus (mouse)
-
Entrez GeneMap4 (a.k.a. AA407148, MAP-4, Mtap-4, Mtap4)
- Promoter T7
-
Tag
/ Fusion Protein
- mClover3 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer M13: GTAAAACGACGGCCAGT
- 3′ sequencing primer GGCTACATTTTGGGGGACAACATTTTGTAAAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Microtubule binding domain of mouse MAP4 (amino acids 658-1126).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-mClover3-MAP4-MTBD was a gift from Melina Schuh (Addgene plasmid # 171498 ; http://n2t.net/addgene:171498 ; RRID:Addgene_171498) -
For your References section:
A liquid-like spindle domain promotes acentrosomal spindle assembly in mammalian oocytes. So C, Seres KB, Steyer AM, Monnich E, Clift D, Pejkovska A, Mobius W, Schuh M. Science. 2019 Jun 28;364(6447). pii: 364/6447/eaat9557. doi: 10.1126/science.aat9557. 10.1126/science.aat9557 PubMed 31249032