-
PurposesgRNA_v1 plasmid for AsCas12f1 in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAsCas12f1_sgRNA_1
-
gRNA/shRNA sequenceattcgtcggttcagcgacgataagccgagaagtgccaataaaactgttaagtggtttggtaacgctcggtaaggtagccaaaaggctgaaactccgtgcacaaagaccgcacggacgcttcacatatagctcataaacaagggtttgcgagctagcttgtggagtgtgaac
-
SpeciesOther
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psgRNAv1-empty was a gift from Quanjiang Ji (Addgene plasmid # 171611 ; http://n2t.net/addgene:171611 ; RRID:Addgene_171611) -
For your References section:
Programmed genome editing by a miniature CRISPR-Cas12f nuclease. Wu Z, Zhang Y, Yu H, Pan D, Wang Y, Wang Y, Li F, Liu C, Nan H, Chen W, Ji Q. Nat Chem Biol. 2021 Sep 2. pii: 10.1038/s41589-021-00868-6. doi: 10.1038/s41589-021-00868-6. 10.1038/s41589-021-00868-6 PubMed 34475565