miR3 Mm ATP13A2
(Plasmid
#171771)
-
Purposetransfer plasmid for lentiviral vector production with miR for Mm ATP13A2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171771 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneSIV tranfserplasmide
-
Backbone manufacturerDidier Nègre
- Backbone size w/o insert (bp) 7445
- Total vector size (bp) 7514
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATP13A2
-
gRNA/shRNA sequencecacgccgaaacactcgttata
-
SpeciesM. musculus (mouse)
-
Entrez GeneAtp13a2 (a.k.a. 1110012E06Rik, AA589443)
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer TCATTTTACTGGGGGACCTTGTGCA
- 3′ sequencing primer caacgggccacaactcctc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miR3 Mm ATP13A2 was a gift from Veerle Baekelandt (Addgene plasmid # 171771 ; http://n2t.net/addgene:171771 ; RRID:Addgene_171771) -
For your References section:
ATP13A2 deficiency disrupts lysosomal polyamine export. van Veen S, Martin S, Van den Haute C, Benoy V, Lyons J, Vanhoutte R, Kahler JP, Decuypere JP, Gelders G, Lambie E, Zielich J, Swinnen JV, Annaert W, Agostinis P, Ghesquiere B, Verhelst S, Baekelandt V, Eggermont J, Vangheluwe P. Nature. 2020 Feb;578(7795):419-424. doi: 10.1038/s41586-020-1968-7. Epub 2020 Jan 29. 10.1038/s41586-020-1968-7 PubMed 31996848