114_UBI_iCre_crystGFP
(Plasmid
#171797)
-
PurposeTol2-plasmid ubiquitously expressing iCre (ubiquitin promoter) along with eGFP selection marker (Crystallin promoter -Lens/Eyes-)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171797 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbone1456-Cryst GFP pminTol2 R4-R2
- Total vector size (bp) 10038
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameoptimised iCre under the control of the Ubiquitin promoter
-
Insert Size (bp)1056
- Promoter Ubiquitin
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACTGGCCGTCGTTTTACA
- 3′ sequencing primer CAGGAAACAGCTATGACCATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
114_UBI_iCre_crystGFP was a gift from Jean Giacomotto (Addgene plasmid # 171797 ; http://n2t.net/addgene:171797 ; RRID:Addgene_171797) -
For your References section:
Optimising the zebrafish Cre/Lox toolbox. Codon improved iCre, new gateway tools, Cre protein and guidelines. Tromp A, Wang H, Hall TE, Mowry B, Giacomotto J. Front Physiol. 2023 Aug 2;14:1221310. doi: 10.3389/fphys.2023.1221310. eCollection 2023. 10.3389/fphys.2023.1221310 PubMed 37601640