pCRISPaint-mNeon-BlastR [M1G]
(Plasmid
#171805)
-
PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein and blasticidin resistance cassette [p.M1G]
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171805 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCRISPaint
-
Backbone manufacturerBased on plasmids published by Schmid-Burgk et al. 2016 (DOI: 10.1038/ncomms12338)
- Backbone size w/o insert (bp) 2577
- Total vector size (bp) 3765
-
Vector typeGene tagging
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeonGreen-T2A-BlastR
-
SpeciesBranchiostoma lanceolatum, Bacillus cereus
-
Insert Size (bp)1188
-
MutationBlastR: Changed Methionin 1 to Glycine.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CGATAGTACTAACATACGCTCTCCA
- 3′ sequencing primer CTCCCCCTGAACCTGAAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPaint-mNeon-BlastR [M1G] was a gift from Michael Hoelzel (Addgene plasmid # 171805 ; http://n2t.net/addgene:171805 ; RRID:Addgene_171805) -
For your References section:
Adoptive T Cell Therapy Targeting Different Gene Products Reveals Diverse and Context-Dependent Immune Evasion in Melanoma. Effern M, Glodde N, Braun M, Liebing J, Boll HN, Yong M, Bawden E, Hinze D, van den Boorn-Konijnenberg D, Daoud M, Aymans P, Landsberg J, Smyth MJ, Flatz L, Tuting T, Bald T, Gebhardt T, Holzel M. Immunity. 2020 Sep 15;53(3):564-580.e9. doi: 10.1016/j.immuni.2020.07.007. Epub 2020 Aug 3. 10.1016/j.immuni.2020.07.007 PubMed 32750334