pLenti HsATP13A2 D508N
(Plasmid
#171820)
-
Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 D508N
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171820 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiviral transferplasmid
-
Backbone manufacturerDidier Trono
- Backbone size w/o insert (bp) 11367
- Total vector size (bp) 14913
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman ATP13A2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3528
-
MutationWT, D962N
-
GenBank IDNP_001135445
-
Entrez GeneATP13A2 (a.k.a. CLN12, HSA9947, KRPPD, PARK9, SPG78)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGACCTTGCATTCCTTTGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti HsATP13A2 D508N was a gift from Veerle Baekelandt (Addgene plasmid # 171820 ; http://n2t.net/addgene:171820 ; RRID:Addgene_171820) -
For your References section:
ATP13A2 deficiency disrupts lysosomal polyamine export. van Veen S, Martin S, Van den Haute C, Benoy V, Lyons J, Vanhoutte R, Kahler JP, Decuypere JP, Gelders G, Lambie E, Zielich J, Swinnen JV, Annaert W, Agostinis P, Ghesquiere B, Verhelst S, Baekelandt V, Eggermont J, Vangheluwe P. Nature. 2020 Feb;578(7795):419-424. doi: 10.1038/s41586-020-1968-7. Epub 2020 Jan 29. 10.1038/s41586-020-1968-7 PubMed 31996848