pCW57.1-FLAG-SRSF3_Full.Length_Codon.Optimized-Blast
(Plasmid
#171951)
-
PurposeAll-in-one lentiviral vector for doxycycline-inducible expression of FLAG-tagged, codon-optimized, full-length SRSF3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57-MCS1-P2A-MCS2 (Blast)
- Backbone size w/o insert (bp) 7446
- Total vector size (bp) 7968
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameserine and arginine rich splicing factor 3
-
Alt nameSRSF3 (codon-optimized)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)522
-
Mutationcodon-optimized
-
GenBank IDNM_003017
-
Entrez GeneSRSF3 (a.k.a. SFRS3, SRp20)
- Promoter TRE
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGTATGTCGAGGTAGGCGTG
- 3′ sequencing primer AGGGCTGCCTTGGAAAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.06.28.450189v3 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1-FLAG-SRSF3_Full.Length_Codon.Optimized-Blast was a gift from Sujatha Jagannathan (Addgene plasmid # 171951 ; http://n2t.net/addgene:171951 ; RRID:Addgene_171951) -
For your References section:
Compromised nonsense-mediated RNA decay results in truncated RNA-binding protein production upon DUX4 expression. Campbell AE, Dyle MC, Albanese R, Matheny T, Sudheendran K, Cortazar MA, Forman T, Fu R, Gillen AE, Caruthers MH, Floor SN, Calviello L, Jagannathan S. Cell Rep. 2023 Jun 13;42(6):112642. doi: 10.1016/j.celrep.2023.112642. 10.1016/j.celrep.2023.112642 PubMed 37314931