Skip to main content

pEA03
(Plasmid #172194)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172194 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pOSV805
  • Backbone manufacturer
    Aubry C. et al. Appl Environ Mic 2019. Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp
  • Backbone size w/o insert (bp) 5835
  • Total vector size (bp) 3104
  • Modifications to backbone
    No integrase and no amilCP modules
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    attR
  • Alt name
    Right attachment site of pSAM2 (minimal attR site as defined in Raynal et al. 1998)
  • Species
    Synthetic
  • Insert Size (bp)
    286

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer ATTTCAGTGCAATTTATCTCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEA03 was a gift from Jean-Luc Pernodet (Addgene plasmid # 172194 ; http://n2t.net/addgene:172194 ; RRID:Addgene_172194)
  • For your References section:

    Marker-Free Genome Engineering in Amycolatopsis Using the pSAM2 Site-Specific Recombination System. Santos LDF, Caraty-Philippe L, Darbon E, Pernodet JL. Microorganisms. 2022 Apr 16;10(4). pii: microorganisms10040828. doi: 10.3390/microorganisms10040828. 10.3390/microorganisms10040828 PubMed 35456877