pEA03
(Plasmid
#172194)
-
PurposeSuicide vector carrying the site attR of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172194 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepOSV805
-
Backbone manufacturerAubry C. et al. Appl Environ Mic 2019. Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp
- Backbone size w/o insert (bp) 5835
- Total vector size (bp) 3104
-
Modifications to backboneNo integrase and no amilCP modules
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameattR
-
Alt nameRight attachment site of pSAM2 (minimal attR site as defined in Raynal et al. 1998)
-
SpeciesSynthetic
-
Insert Size (bp)286
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer ATTTCAGTGCAATTTATCTCTTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEA03 was a gift from Jean-Luc Pernodet (Addgene plasmid # 172194 ; http://n2t.net/addgene:172194 ; RRID:Addgene_172194) -
For your References section:
Marker-Free Genome Engineering in Amycolatopsis Using the pSAM2 Site-Specific Recombination System. Santos LDF, Caraty-Philippe L, Darbon E, Pernodet JL. Microorganisms. 2022 Apr 16;10(4). pii: microorganisms10040828. doi: 10.3390/microorganisms10040828. 10.3390/microorganisms10040828 PubMed 35456877