Skip to main content
Addgene

pTwist-FLAG-SRSF3_Full.Length_Codon.Optimized
(Plasmid #172345)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172345 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTwist
  • Backbone manufacturer
    Twist Bioscience
  • Backbone size w/o insert (bp) 4843
  • Total vector size (bp) 5365
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    serine and arginine rich splicing factor 3
  • Alt name
    SRSF3 (codon-optimized)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    522
  • Mutation
    codon-optimized
  • GenBank ID
    NM_003017
  • Entrez Gene
    SRSF3 (a.k.a. SFRS3, SRp20)
  • Promoter EF-1a
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTwist-FLAG-SRSF3_Full.Length_Codon.Optimized was a gift from Sujatha Jagannathan (Addgene plasmid # 172345 ; http://n2t.net/addgene:172345 ; RRID:Addgene_172345)
  • For your References section:

    Compromised nonsense-mediated RNA decay results in truncated RNA-binding protein production upon DUX4 expression. Campbell AE, Dyle MC, Albanese R, Matheny T, Sudheendran K, Cortazar MA, Forman T, Fu R, Gillen AE, Caruthers MH, Floor SN, Calviello L, Jagannathan S. Cell Rep. 2023 Jun 13;42(6):112642. doi: 10.1016/j.celrep.2023.112642. 10.1016/j.celrep.2023.112642 PubMed 37314931