pIA1364
(Plasmid
#172401)
-
PurposeExpression of SARS-COV-2 Nsp9 (extra GS at the N-terminal) in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172401 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
- Total vector size (bp) 5724
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSARS-COV-2 Nsp9
-
SpeciesSynthetic
-
Insert Size (bp)577
-
GenBank ID
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter T7
-
Tag
/ Fusion Protein
- His-GB1 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIA1364 was a gift from Irina Artsimovitch (Addgene plasmid # 172401 ; http://n2t.net/addgene:172401 ; RRID:Addgene_172401) -
For your References section:
NMPylation and de-NMPylation of SARS-CoV-2 nsp9 by the NiRAN domain. Wang B, Svetlov D, Artsimovitch I. Nucleic Acids Res. 2021 Aug 5. pii: 6342456. doi: 10.1093/nar/gkab677. 10.1093/nar/gkab677 PubMed 34352100