Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

MAC-CTSB
(Plasmid #172413)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172413 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    MAC-tag-C
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cathepsin B
  • Alt name
    CTSB
  • Species
    H. sapiens (human)
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • MAC-tag (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CMVfor :CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer pCR3.1-BGHrev: TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MAC-CTSB was a gift from Markku Varjosalo (Addgene plasmid # 172413 ; http://n2t.net/addgene:172413 ; RRID:Addgene_172413)
  • For your References section:

    SARS-CoV-2-host proteome interactions for antiviral drug discovery. Liu X, Huuskonen S, Laitinen T, Redchuk T, Bogacheva M, Salokas K, Pohner I, Ohman T, Tonduru AK, Hassinen A, Gawriyski L, Keskitalo S, Vartiainen MK, Pietiainen V, Poso A, Varjosalo M. Mol Syst Biol. 2021 Nov;17(11):e10396. doi: 10.15252/msb.202110396. 10.15252/msb.202110396 PubMed 34709727