pLV_PP1-mCitrine
(Plasmid
#172472)
-
PurposeMammalian expression of a human codon-optimized version of the optogenetic GPCR parapinopsina (PP1) from zebrafish fused to mCitrine. Also contains an N-terminal prolactin signal sequence.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Davis
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172472 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti 2nd gen
- Backbone size w/o insert (bp) 8740
- Total vector size (bp) 10609
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameprolactinSS-PP1-mCitrine
-
Alt namezebrafish parapinopsina (PP1)
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1869
-
Entrez Geneparapinopsina (a.k.a. pp1, uvpp)
- Promoter EF1alpha
-
Tags
/ Fusion Proteins
- mCitrine (C terminal on insert)
- prolactin signal sequence (cleaved post-translationally) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggagtacgtcgtctttaggt
- 3′ sequencing primer cgtcttttggcaatgtgagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV_PP1-mCitrine was a gift from Sean R Collins (Addgene plasmid # 172472 ; http://n2t.net/addgene:172472 ; RRID:Addgene_172472) -
For your References section:
Optogenetic control of receptors reveals distinct roles for actin- and Cdc42-dependent negative signals in chemotactic signal processing. Bell GRR, Rincon E, Akdogan E, Collins SR. Nat Commun. 2021 Nov 16;12(1):6148. doi: 10.1038/s41467-021-26371-z. 10.1038/s41467-021-26371-z PubMed 34785668