pLV_PP1-mCitrine
(Plasmid #172472)

• Purpose: Mammalian expression of a human codon-optimized version of the optogenetic GPCR parapinopsina (PP1) from zebrafish fused to mCitrine. Also contains an N-terminal prolactin signal sequence.
• Depositing Lab: Sean R Collins
• Publication: Bell et al Nat Commun. 2021 Nov 16;12(1):6148. doi: 10.1038/s41467-021-26371-z.

Backbone

• Vector backbone: pLenti 2nd gen
• Backbone size w/o insert (bp): 8740
• Total vector size (bp): 10609
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: prolactinSS-PP1-mCitrine
• Alt name: zebrafish parapinopsina (PP1)
• Species: D. rerio (zebrafish)
• Insert Size (bp): 1869
• Entrez Gene: parapinopsina (a.k.a. pp1, uvpp)
• Promoter: EF1alpha
• Tags / Fusion Proteins:
  • mCitrine (C terminal on insert)
  • prolactin signal sequence (cleaved post-translationally) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ggagtacgtcgtctttaggt
• 3′ sequencing primer: cgtcttttggcaatgtgagg

Resource Information

• Supplemental Documents:
  • pLV_PP1-mCitrine.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry