Skip to main content
Addgene

pPB_Cdc42-TomKat-sensor-CAAX
(Plasmid #172473)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172473 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPB
  • Backbone size w/o insert (bp) 6785
  • Total vector size (bp) 10943
  • Vector type
    Mammalian Expression ; Piggybac transposon
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tdKatushka2-PBD(Pak1)-EVlinker-Cdc42-tdTomato-CAAX
  • Alt name
    Cdc42 TomKat sensor
  • Species
    Synthetic
  • Insert Size (bp)
    4158
  • Promoter CAG
  • Tags / Fusion Proteins
    • polybasic and CAAX motif from Kras (C terminal on insert)
    • tdTomato
    • tdKatushka2

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cttctggcgtgtgaccg
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This sensor is a modified version of a sensor originally developed by Michiyuki Matsuda's lab.
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This sensor is based on the design of the Matsuda lab (https://www.ncbi.nlm.nih.gov/pubmed/21976697) but modified to use tdTomato as the FRET donor and tdKatushka as the FRET acceptor. The tdKatushka2 was originally cloned by Michael Davidson's lab (Addgene plasmid #56049).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPB_Cdc42-TomKat-sensor-CAAX was a gift from Sean R Collins (Addgene plasmid # 172473 ; http://n2t.net/addgene:172473 ; RRID:Addgene_172473)
  • For your References section:

    Optogenetic control of receptors reveals distinct roles for actin- and Cdc42-dependent negative signals in chemotactic signal processing. Bell GRR, Rincon E, Akdogan E, Collins SR. Nat Commun. 2021 Nov 16;12(1):6148. doi: 10.1038/s41467-021-26371-z. 10.1038/s41467-021-26371-z PubMed 34785668