Skip to main content

px458-AMBRA1 #3
(Plasmid #172607)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172607 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px458
  • Backbone manufacturer
    F. Zhang (Addgene plasmid #48138)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA against AMBRA1
  • gRNA/shRNA sequence
    TGGTAGAAGATAAAACCCGG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    AMBRA1 (a.k.a. DCAF3, WDR94)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px458-AMBRA1 #3 was a gift from Michele Pagano (Addgene plasmid # 172607 ; http://n2t.net/addgene:172607 ; RRID:Addgene_172607)
  • For your References section:

    CRL4(AMBRA1) is a master regulator of D-type cyclins. Simoneschi D, Rona G, Zhou N, Jeong YT, Jiang S, Milletti G, Arbini AA, O'Sullivan A, Wang AA, Nithikasem S, Keegan S, Siu Y, Cianfanelli V, Maiani E, Nazio F, Cecconi F, Boccalatte F, Fenyo D, Jones DR, Busino L, Pagano M. Nature. 2021 Apr;592(7856):789-793. doi: 10.1038/s41586-021-03445-y. Epub 2021 Apr 14. 10.1038/s41586-021-03445-y PubMed 33854235