Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

p2GLex
(Plasmid #17263)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 17263 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCGLex
  • Backbone size (bp) 8930
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • LexA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGTCAGCAGAGCTTCACCATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2GLex was a gift from Stuart Schreiber (Addgene plasmid # 17263 ; http://n2t.net/addgene:17263 ; RRID:Addgene_17263)
  • For your References section:

    A yeast genetic system for selecting small molecule inhibitors of protein-protein interactions in nanodroplets. Huang J, Schreiber SL. Proc Natl Acad Sci U S A. 1997 Dec 9. 94(25):13396-401. 10.1073/pnas.94.25.13396 PubMed 9391035