pGLOW31
(Plasmid
#172698)
-
PurposeC. elegans mScarlet co-injection marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172698 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backboneN/A
- Backbone size w/o insert (bp) 2445
- Total vector size (bp) 6622
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePmyo-3::mScarlet
-
Alt namePmyo-3::mScarlet-I-C1::unc-54utr
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)4175
- Promoter myo-3
-
Tag
/ Fusion Protein
- mScarlet
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AATTTTCAGGGCAGGGAGCC
- 3′ sequencing primer GGGAGCACAGGGAGAAAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDerived from pCFJ104 (Addgene #19328) and pMS050 (Addgene #91826)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
C. elegans codon-optimized mScarlet. Use as a co-injection marker. pGLOW31 mScarlet fluorescence is brighter than pCFJ104 mCherry fluorescence in body wall muscle. Inject at 5 ng/uL. Made by George Huang (Glow Worms '20).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGLOW31 was a gift from Ryan Doonan (Addgene plasmid # 172698 ; http://n2t.net/addgene:172698 ; RRID:Addgene_172698) -
For your References section:
mScarlet and split fluorophore mScarlet resources for plasmid-based CRISPR/Cas9 knock-in in C. elegans. Witten G, DeMott E, Huang G, Zelasko F, de Jesus B, Mulchand C, Schuck L, Pullman S, Perez A, Mahableshwarkar P, Wu Z, Cardona EA, Pierce JT, Dickinson DJ, Doonan R. MicroPubl Biol. 2023 Jun 14;2023:10.17912/micropub.biology.000871. doi: 10.17912/micropub.biology.000871. eCollection 2023. 10.17912/micropub.biology.000871 PubMed 37396790