Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSin-NE1m
(Plasmid #172883)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172883 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSinRep5
  • Backbone size w/o insert (bp) 9951
  • Total vector size (bp) 11937
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NE SENSOR
  • Alt name
    NE1m
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1998
  • Promoter sp6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (destroyed during cloning)
  • 3′ cloning site Sph1 (not destroyed)
  • 5′ sequencing primer AGCATAGTACATTTCATCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    From Yulong Li

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSin-NE1m was a gift from J. Julius Zhu (Addgene plasmid # 172883 ; http://n2t.net/addgene:172883 ; RRID:Addgene_172883)
  • For your References section:

    A Genetically Encoded Fluorescent Sensor for Rapid and Specific In Vivo Detection of Norepinephrine. Feng J, Zhang C, Lischinsky JE, Jing M, Zhou J, Wang H, Zhang Y, Dong A, Wu Z, Wu H, Chen W, Zhang P, Zou J, Hires SA, Zhu JJ, Cui G, Lin D, Du J, Li Y. Neuron. 2019 May 22;102(4):745-761.e8. doi: 10.1016/j.neuron.2019.02.037. Epub 2019 Mar 25. 10.1016/j.neuron.2019.02.037 PubMed 30922875