pSin-NE1m
(Plasmid
#172883)
-
PurposeExpresses the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m in neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSinRep5
- Backbone size w/o insert (bp) 9951
- Total vector size (bp) 11937
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNE SENSOR
-
Alt nameNE1m
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1998
- Promoter sp6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (destroyed during cloning)
- 3′ cloning site Sph1 (not destroyed)
- 5′ sequencing primer AGCATAGTACATTTCATCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFrom Yulong Li
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSin-NE1m was a gift from J. Julius Zhu (Addgene plasmid # 172883 ; http://n2t.net/addgene:172883 ; RRID:Addgene_172883) -
For your References section:
A Genetically Encoded Fluorescent Sensor for Rapid and Specific In Vivo Detection of Norepinephrine. Feng J, Zhang C, Lischinsky JE, Jing M, Zhou J, Wang H, Zhang Y, Dong A, Wu Z, Wu H, Chen W, Zhang P, Zou J, Hires SA, Zhu JJ, Cui G, Lin D, Du J, Li Y. Neuron. 2019 May 22;102(4):745-761.e8. doi: 10.1016/j.neuron.2019.02.037. Epub 2019 Mar 25. 10.1016/j.neuron.2019.02.037 PubMed 30922875