pET22b-PelB-6H-Ag43-160N-sfGFP
(Plasmid
#172886)
-
PurposeDisplay sfGFP protein on E. coli cell surface
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172886 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET22b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5359
- Total vector size (bp) 8727
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSfGFP
-
Alt nameSfGFP
-
SpeciesSynthetic
-
Insert Size (bp)714
- Promoter T7 Promoter
-
Tags
/ Fusion Proteins
- HHHHHH (N terminal on insert)
- TEV recognition site (ENLYFQG) (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAg43, partial
-
Alt nameflu gene
-
Insert Size (bp)1107
-
MutationDeleted 1-160 (N terminal)
-
Entrez Geneflu (a.k.a. b2000, ECK1993, agn, agn43, yeeQ, yzzX)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAAACCTGTACTTTCAGGGC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bysfGFP amplified from pJT119b vector (addgene #50551)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22b-PelB-6H-Ag43-160N-sfGFP was a gift from Urartu Seker (Addgene plasmid # 172886 ; http://n2t.net/addgene:172886 ; RRID:Addgene_172886) -
For your References section:
A Self-Actuated Cellular Protein Delivery Machine. Ahan RE, Kirpat BM, Saltepe B, Seker UOS. ACS Synth Biol. 2019 Apr 19;8(4):686-696. doi: 10.1021/acssynbio.9b00062. Epub 2019 Mar 12. 10.1021/acssynbio.9b00062 PubMed 30811932