pET22b-6h-GST-TEVp
(Plasmid
#172887)
-
PurposeCodon optimized (E. coli) TEVp fused with GST and his-tagged for purification
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET22b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5359
- Total vector size (bp) 6779
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTEV protease
-
Alt nameTevp
-
Alt nameTobacco etch virus protease
-
SpeciesSynthetic
-
Insert Size (bp)708
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- GST solubility tag (N terminal on insert)
- HHHHHH (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22b-6h-GST-TEVp was a gift from Urartu Seker (Addgene plasmid # 172887 ; http://n2t.net/addgene:172887 ; RRID:Addgene_172887) -
For your References section:
A Self-Actuated Cellular Protein Delivery Machine. Ahan RE, Kirpat BM, Saltepe B, Seker UOS. ACS Synth Biol. 2019 Apr 19;8(4):686-696. doi: 10.1021/acssynbio.9b00062. Epub 2019 Mar 12. 10.1021/acssynbio.9b00062 PubMed 30811932