pGP-CAG-Ace2N-4AA-mNeon A122D-WPRE-bGH-polyA
(Plasmid
#172911)
-
PurposeMammalian expression of voltage sensor
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneunknown
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAce2N-4AA-mNeon A122D
-
Alt nameAce2N-4AA-mNeon insert
-
Alt namevariant 487.6
-
SpeciesSynthetic
-
Insert Size (bp)1452
-
MutationA122D
- Promoter CAG
-
Tag
/ Fusion Protein
- soma localization targeting sequence (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TTAAAGCAGCGTATCCACAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.11.09.467909 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGP-CAG-Ace2N-4AA-mNeon A122D-WPRE-bGH-polyA was a gift from GENIE Project (Addgene plasmid # 172911 ; http://n2t.net/addgene:172911 ; RRID:Addgene_172911) -
For your References section:
Sensitivity optimization of a rhodopsin-based fluorescent voltage indicator. Abdelfattah AS, Zheng J, Singh A, Huang YC, Reep D, Tsegaye G, Tsang A, Arthur BJ, Rehorova M, Olson CVL, Shuai Y, Zhang L, Fu TM, Milkie DE, Moya MV, Weber TD, Lemire AL, Baker CA, Falco N, Zheng Q, Grimm JB, Yip MC, Walpita D, Chase M, Campagnola L, Murphy GJ, Wong AM, Forest CR, Mertz J, Economo MN, Turner GC, Koyama M, Lin BJ, Betzig E, Novak O, Lavis LD, Svoboda K, Korff W, Chen TW, Schreiter ER, Hasseman JP, Kolb I. Neuron. 2023 Mar 28:S0896-6273(23)00205-2. doi: 10.1016/j.neuron.2023.03.009. 10.1016/j.neuron.2023.03.009 PubMed 37015225