Skip to main content
Addgene

Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
(Plasmid #173029)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173029 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EF1a-lenti
  • Backbone size w/o insert (bp) 9202
  • Total vector size (bp) 13351
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    BFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pspCas13b
  • Alt name
    pspCas13b
  • Species
    Prevotella pectinovora
  • Insert Size (bp)
    4149
  • GenBank ID
    WP_044065294
  • Promoter Ef1a
  • Tags / Fusion Proteins
    • HIV NES (C terminal on insert)
    • 3xFLAG (C terminal on insert)
    • T2A (C terminal on insert)
    • BFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATTGAGGGCGAGCAGAACGAGAA
  • 3′ sequencing primer tggggcacaagcttaattga
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The plasmid was obtained from Addgene (#103862) initially cloned by the Feng Zhang lab (Cox et al, 2017) that we modified by adding 3xFLAG, T2A, and BFP tags at the C-terminus.
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP was a gift from Mohamed Fareh (Addgene plasmid # 173029 ; http://n2t.net/addgene:173029 ; RRID:Addgene_173029)
  • For your References section:

    Reprogrammed CRISPR-Cas13b suppresses SARS-CoV-2 replication and circumvents its mutational escape through mismatch tolerance. Fareh M, Zhao W, Hu W, Casan JML, Kumar A, Symons J, Zerbato JM, Fong D, Voskoboinik I, Ekert PG, Rudraraju R, Purcell DFJ, Lewin SR, Trapani JA. Nat Commun. 2021 Jul 13;12(1):4270. doi: 10.1038/s41467-021-24577-9. 10.1038/s41467-021-24577-9 PubMed 34257311