Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
(Plasmid #173029)

• Purpose: For expression of cytoplasmic pspCas13b protein tagged with 3xHA-T2A-BFP for gene silencing in mamallian cells.
• Depositing Lab: Mohamed Fareh
• Publication: Fareh et al Nat Commun. 2021 Jul 13;12(1):4270. doi: 10.1038/s41467-021-24577-9.

Backbone

• Vector backbone: EF1a-lenti
• Backbone size w/o insert (bp): 9202
• Total vector size (bp): 13351
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: BFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pspCas13b
• Alt name: pspCas13b
• Species: Prevotella pectinovora
• Insert Size (bp): 4149
• GenBank ID: WP_044065294
• Promoter: Ef1a
• Tags / Fusion Proteins:
  • HIV NES (C terminal on insert)
  • 3xFLAG (C terminal on insert)
  • T2A (C terminal on insert)
  • BFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATTGAGGGCGAGCAGAACGAGAA
• 3′ sequencing primer: tggggcacaagcttaattga

Resource Information

• Supplemental Documents:
  • EF1-PspCas13b-NES-HIV-T2A-BFP_GenBank.gbk
• A portion of this plasmid was derived from a plasmid made by: The plasmid was obtained from Addgene (#103862) initially cloned by the Feng Zhang lab (Cox et al, 2017) that we modified by adding 3xFLAG, T2A, and BFP tags at the C-terminus.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry