Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
(Plasmid
#173029)
-
PurposeFor expression of cytoplasmic pspCas13b protein tagged with 3xHA-T2A-BFP for gene silencing in mamallian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173029 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEF1a-lenti
- Backbone size w/o insert (bp) 9202
- Total vector size (bp) 13351
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepspCas13b
-
Alt namepspCas13b
-
SpeciesPrevotella pectinovora
-
Insert Size (bp)4149
-
GenBank IDWP_044065294
- Promoter Ef1a
-
Tags
/ Fusion Proteins
- HIV NES (C terminal on insert)
- 3xFLAG (C terminal on insert)
- T2A (C terminal on insert)
- BFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATTGAGGGCGAGCAGAACGAGAA
- 3′ sequencing primer tggggcacaagcttaattga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe plasmid was obtained from Addgene (#103862) initially cloned by the Feng Zhang lab (Cox et al, 2017) that we modified by adding 3xFLAG, T2A, and BFP tags at the C-terminus.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP was a gift from Mohamed Fareh (Addgene plasmid # 173029 ; http://n2t.net/addgene:173029 ; RRID:Addgene_173029) -
For your References section:
Reprogrammed CRISPR-Cas13b suppresses SARS-CoV-2 replication and circumvents its mutational escape through mismatch tolerance. Fareh M, Zhao W, Hu W, Casan JML, Kumar A, Symons J, Zerbato JM, Fong D, Voskoboinik I, Ekert PG, Rudraraju R, Purcell DFJ, Lewin SR, Trapani JA. Nat Commun. 2021 Jul 13;12(1):4270. doi: 10.1038/s41467-021-24577-9. 10.1038/s41467-021-24577-9 PubMed 34257311