AAV-Camk2-NES-Twitch-GR
(Plasmid
#173044)
-
PurposeTnC-based calcium sensor with green-red FRET pair ratiometric readout
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneLentivirus
- Backbone size w/o insert (bp) 9251
- Total vector size (bp) 10937
-
Modifications to backbonenone
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-Twitch-GR
-
Insert Size (bp)1686
- Promoter CamK2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTCAAGCCGGTTCTCCGTTTGCACTC
- 3′ sequencing primer CAGCGTATCCACATAGCGTAAAAGGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-Camk2-NES-Twitch-GR was a gift from Yiyang Gong (Addgene plasmid # 173044 ; http://n2t.net/addgene:173044 ; RRID:Addgene_173044) -
For your References section:
Rational engineering of ratiometric calcium sensors with bright green and red fluorescent proteins. Zhang D, Redington E, Gong Y. Commun Biol. 2021 Jul 29;4(1):924. doi: 10.1038/s42003-021-02452-z. 10.1038/s42003-021-02452-z PubMed 34326458