CTV
(Plasmid #27803)

• Depositing Lab: Steven Vogel
• Publication: Koushik et al J Biomed Opt. . 13(3):031204.

Backbone

• Vector backbone: pEGFP C1
• Backbone size w/o insert (bp): 3984
• Vector type: Mammalian Expression ; FRET standard
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cerulean Traf Venus
• Insert Size (bp): 2138

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe 1 (not destroyed)
• 3′ cloning site: Bam HI (not destroyed)
• 5′ sequencing primer: CCAAAATCAACGGGACTTTCC
• 3′ sequencing primer: CAGGTTCAGGGGGAGGTGTGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

FRET standard

Contains TRAF2 nucleotides 874-1561 from NM_021138.