pJET1.2-U3
(Plasmid
#173156)
-
PurposeSingle guide RNA cassette under U3 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJet1.2
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 3871
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA cassette under U3 promoter
-
gRNA/shRNA sequenceATCGAGCTCCCGTGATCCAG
-
SpeciesA. thaliana (mustard weed)
-
GenBank ID832208
- Promoter promoter region of the U3C snRNA gene (Marshallsay et al. 1990) from A. thaliana (Ler ecotype).
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site None (blunt end ligation with a PCR product) (unknown if destroyed)
- 5′ sequencing primer TAA TAC GAC TCA CTA TAG GG
- 3′ sequencing primer ATT AAC CCT CAC TAA AGG GA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector was designed and constructed by Dr. Tomasz Bieluszewski.
Detailed protocol for CRISPR/Cas9-based mutagenesis using this system in:
Bieluszewski T, Szymanska-Lejman M, Dziegielewski W, Zhu L, Ziolkowski PA. Efficient Generation of CRISPR/Cas9-Based Mutants Supported by Fluorescent Seed Selection in Different Arabidopsis Accessions, in: Plant Gametogenesis: Methods and Protocols (ed. Christophe Lambing), Methods in Molecular Biology, vol. 2484.
https://doi.org/10.1007/978-1-0716-2253-7_13
https://pubmed.ncbi.nlm.nih.gov/35461452/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET1.2-U3 was a gift from Piotr Ziolkowski (Addgene plasmid # 173156 ; http://n2t.net/addgene:173156 ; RRID:Addgene_173156) -
For your References section:
NuA4 and H2A.Z control environmental responses and autotrophic growth in Arabidopsis. Bieluszewski T, Sura W, Dziegielewski W, Bieluszewska A, Lachance C, Kabza M, Szymanska-Lejman M, Abram M, Wlodzimierz P, De Winne N, De Jaeger G, Sadowski J, Cote J, Ziolkowski PA. Nat Commun. 2022 Jan 12;13(1):277. doi: 10.1038/s41467-021-27882-5. 10.1038/s41467-021-27882-5 PubMed 35022409