Skip to main content
Addgene

pJET1.2-U3
(Plasmid #173156)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173156 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJet1.2
  • Backbone manufacturer
    Thermo Scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 3871
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA cassette under U3 promoter
  • gRNA/shRNA sequence
    ATCGAGCTCCCGTGATCCAG
  • Species
    A. thaliana (mustard weed)
  • GenBank ID
    832208
  • Promoter promoter region of the U3C snRNA gene (Marshallsay et al. 1990) from A. thaliana (Ler ecotype).

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site None (blunt end ligation with a PCR product) (unknown if destroyed)
  • 5′ sequencing primer TAA TAC GAC TCA CTA TAG GG
  • 3′ sequencing primer ATT AAC CCT CAC TAA AGG GA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector was designed and constructed by Dr. Tomasz Bieluszewski.

Detailed protocol for CRISPR/Cas9-based mutagenesis using this system in:
Bieluszewski T, Szymanska-Lejman M, Dziegielewski W, Zhu L, Ziolkowski PA. Efficient Generation of CRISPR/Cas9-Based Mutants Supported by Fluorescent Seed Selection in Different Arabidopsis Accessions, in: Plant Gametogenesis: Methods and Protocols (ed. Christophe Lambing), Methods in Molecular Biology, vol. 2484.
https://doi.org/10.1007/978-1-0716-2253-7_13
https://pubmed.ncbi.nlm.nih.gov/35461452/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET1.2-U3 was a gift from Piotr Ziolkowski (Addgene plasmid # 173156 ; http://n2t.net/addgene:173156 ; RRID:Addgene_173156)
  • For your References section:

    NuA4 and H2A.Z control environmental responses and autotrophic growth in Arabidopsis. Bieluszewski T, Sura W, Dziegielewski W, Bieluszewska A, Lachance C, Kabza M, Szymanska-Lejman M, Abram M, Wlodzimierz P, De Winne N, De Jaeger G, Sadowski J, Cote J, Ziolkowski PA. Nat Commun. 2022 Jan 12;13(1):277. doi: 10.1038/s41467-021-27882-5. 10.1038/s41467-021-27882-5 PubMed 35022409