pX330_ATP1A1_G3_Dual_sgRNA
(Plasmid
#173205)
-
PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
- Total vector size (bp) 8804
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP1A1 G3 sgRNA + user-specified sgRNA + SpCas9
-
gRNA/shRNA sequenceGAGTTCTGTAATTCAGCATA
-
SpeciesH. sapiens (human)
- Promoter Dual U6 promoters
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SbfI (not destroyed)
- 5′ sequencing primer GGATTGGGAAGACAATAGCAGGC
- 3′ sequencing primer GTCCCTATTGGCGTTACTATTGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ATP1A1 G3 sgRNA target ATP1A1 intron 4 and this plasmid can be used to perform coselection for HDR in human cells. This plasmid is derived from pX330-U6-Chimeric_BB-CBh-hSpCas9 and user-specified sgRNA can be cloned using the BbsI sites. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330_ATP1A1_G3_Dual_sgRNA was a gift from Yannick Doyon (Addgene plasmid # 173205 ; http://n2t.net/addgene:173205 ; RRID:Addgene_173205) -
For your References section:
Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338