pCAG1.1
(Plasmid
#173685)
-
Purpose(Empty Backbone) The expression vector for genes of interest under CAG promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173685 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBluescript SKII (+)
-
Modifications to backbonepCAGGS was used as an original vector.
-
Vector typeMammalian Expression
- Promoter CAG promoter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer agcggataacaatttcacacaggaaac
- 3′ sequencing primer cgccagggttttcccagtcacgac (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG1.1 was a gift from Masahito Ikawa (Addgene plasmid # 173685 ; http://n2t.net/addgene:173685 ; RRID:Addgene_173685) -
For your References section:
Calsperin is a testis-specific chaperone required for sperm fertility. Ikawa M, Tokuhiro K, Yamaguchi R, Benham AM, Tamura T, Wada I, Satouh Y, Inoue N, Okabe M. J Biol Chem. 2011 Feb 18;286(7):5639-46. doi: 10.1074/jbc.M110.140152. Epub 2010 Dec 3. 10.1074/jbc.M110.140152 PubMed 21131354