-
PurposeInducibly expresses SRRM2-mCherry in mammalian cells with the Tet-on system
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLVX
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 7756
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSRRM2
-
Alt nameSerine/Arginine Repetitive Matrix 2
-
Alt nameTax-Responsive Enhancer Element-Binding Protein 803
-
Alt nameSplicing Coactivator Subunit SRm300
-
SpeciesH. sapiens (human)
-
Insert Size (bp)8253
-
GenBank ID23524
-
Entrez GeneSRRM2 (a.k.a. 300-KD, CWF21, Cwc21, HSPC075, MRD72, SRL300, SRm300)
- Promoter TREtight
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtcgaggtaggcgtgtacgg
- 3′ sequencing primer gaggccagaggccacttgtgtag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLukas Pelkmans and Arpan Rai, University of Zurich
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-SRRM2-mCherry was a gift from Wesley Sundquist & Katie Ullman (Addgene plasmid # 174089 ; http://n2t.net/addgene:174089 ; RRID:Addgene_174089) -
For your References section:
Identification of abscission checkpoint bodies as structures that regulate ESCRT factors to control abscission timing. Williams LK, Mackay DR, Whitney MA, Couldwell GC, Sundquist WI, Ullman KS. Elife. 2021 Aug 4;10. pii: 63743. doi: 10.7554/eLife.63743. 10.7554/eLife.63743 PubMed 34346309