dCas9-10xSunTag-P2A-tagBFP
(Plasmid
#174141)
-
PurposeExpresses the dCas9-10xSunTag-tagBFP fusion protein for the recruitment of scFv(GCN4)-fused effector domains. A shorter version of the Addgene 60903 plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174141 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAmpR-Ori
- Backbone size w/o insert (bp) 5706
- Total vector size (bp) 10032
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9, 10xSunTag, tagBFP
-
SpeciesSynthetic; Streptococcus pyogenes
-
Insert Size (bp)5958
-
GenBank ID
- Promoter SV40
-
Tags
/ Fusion Proteins
- HA
- tagBFP (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGCGAGTCAGTGAGCGAG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene 60903
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Shorter version of the original plasmid, in which a 4.5-kb fragment in the vector backbone was deleted
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dCas9-10xSunTag-P2A-tagBFP was a gift from Albert Jeltsch (Addgene plasmid # 174141 ; http://n2t.net/addgene:174141 ; RRID:Addgene_174141) -
For your References section:
Engineering of Effector Domains for Targeted DNA Methylation with Reduced Off-Target Effects. Hofacker D, Broche J, Laistner L, Adam S, Bashtrykov P, Jeltsch A. Int J Mol Sci. 2020 Jan 13;21(2). pii: ijms21020502. doi: 10.3390/ijms21020502. 10.3390/ijms21020502 PubMed 31941101