lentiCRISPRv2_sgCtrl#2
(Plasmid
#174149)
-
PurposeLentiviral vector expressing Cas9 and a control sgRNA that targets a safe harbor site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174149 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameControl sgRNA
-
gRNA/shRNA sequenceGATCCTTATTGCTCCATTCT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmbI (destroyed during cloning)
- 3′ cloning site BsmbI (destroyed during cloning)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPRv2_sgCtrl#2 was a gift from Julien Sage (Addgene plasmid # 174149 ; http://n2t.net/addgene:174149 ; RRID:Addgene_174149) -
For your References section:
The AMBRA1 E3 ligase adaptor regulates the stability of cyclin D. Chaikovsky AC, Li C, Jeng EE, Loebell S, Lee MC, Murray CW, Cheng R, Demeter J, Swaney DL, Chen SH, Newton BW, Johnson JR, Drainas AP, Shue YT, Seoane JA, Srinivasan P, He A, Yoshida A, Hipkins SQ, McCrea E, Poltorack CD, Krogan NJ, Diehl JA, Kong C, Jackson PK, Curtis C, Petrov DA, Bassik MC, Winslow MM, Sage J. Nature. 2021 Apr;592(7856):794-798. doi: 10.1038/s41586-021-03474-7. Epub 2021 Apr 14. 10.1038/s41586-021-03474-7 PubMed 33854239