pWL502-PAM
(Plasmid
#174382)
-
PurposePlasmids bearing protospacer sequences with functional PAM efficiently triggered CRISPR-mediated defense in cells with corresponding spacer sequence; article demonstrates use in Haloferax mediterranei
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174382 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepWL502
- Backbone size w/o insert (bp) 7876
- Total vector size (bp) 7899
-
Vector typeBacterial Expression, CRISPR ; archaeal expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePAM-spacer
-
gRNA/shRNA sequenceTTGATCCGGTCCCAGTAGAGCGCGTAGACGCCGAGGGC
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWL502-PAM was a gift from Jing Han (Addgene plasmid # 174382 ; http://n2t.net/addgene:174382 ; RRID:Addgene_174382) -
For your References section:
Optimising PHBV biopolymer production in haloarchaea via CRISPRi-mediated redirection of carbon flux. Lin L, Chen J, Mitra R, Gao Q, Cheng F, Xu T, Zuo Z, Xiang H, Han J. Commun Biol. 2021 Aug 25;4(1):1007. doi: 10.1038/s42003-021-02541-z. 10.1038/s42003-021-02541-z PubMed 34433872