-
PurposeC. auris LEUpOUT NAT marker CAS9 expression construct. Use with pCE27 gRNA expression construct.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2242
- Total vector size (bp) 9204
-
Vector typeBacterial Expression, CRISPR
-
Selectable markersNourseothricin (NAT)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC. auris LEU2 1 of 2, pENO1, Cas9, NAT 1 of 2
-
SpeciesCandida auris
-
Insert Size (bp)6962
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cacatttccccgaaaagtg
- 3′ sequencing primer CTCACTGCCCGCTTTCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCE35 was a gift from Clarissa Nobile (Addgene plasmid # 174409 ; http://n2t.net/addgene:174409 ; RRID:Addgene_174409) -
For your References section:
A Markerless CRISPR-Mediated System for Genome Editing in Candida auris Reveals a Conserved Role for Cas5 in the Caspofungin Response. Ennis CL, Hernday AD, Nobile CJ. Microbiol Spectr. 2021 Dec 22;9(3):e0182021. doi: 10.1128/Spectrum.01820-21. Epub 2021 Nov 3. 10.1128/Spectrum.01820-21 PubMed 34730409