-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C2
-
Backbone manufacturerBD Biosciences Clontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Growth instructionsTOP-10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesmall heat shock protein27
-
Alt nameHSPB1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)633
-
GenBank IDBC012768
-
Entrez GeneHSPB1 (a.k.a. CMT2F, HEL-S-102, HMN2B, HMND3, HS.76067, HSP27, HSP28, Hsp25, SRP27)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR I (not destroyed)
- 3′ cloning site Sal I (not destroyed)
- 5′ sequencing primer GGGATCCTAGAATTCGCCCACCATGACCGAGCGCCGCGT
- 3′ sequencing primer CTCGAGGTCGACCTTGGCGGCAGTCTCATC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-hsp27 wt FL was a gift from Andrea Doseff (Addgene plasmid # 17444 ; http://n2t.net/addgene:17444 ; RRID:Addgene_17444) -
For your References section:
Binding of caspase-3 prodomain to heat shock protein 27 regulates monocyte apoptosis by inhibiting caspase-3 proteolytic activation. Voss OH, Batra S, Kolattukudy SJ, Gonzalez-Mejia ME, Smith JB, Doseff AI. J Biol Chem. 2007 Aug 24. 282(34):25088-99. 10.1074/jbc.M701740200 PubMed 17597071