Skip to main content

AAV sgRNA Expression Plasmid
(Plasmid #174540)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174540 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pCWB
  • Backbone size (bp) 5067
  • Vector type
    Mammalian Expression, AAV
  • Promoter CMV
  • Selectable markers
    mCherry
  • Tag / Fusion Protein
    • None (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tttcccatgattccttcata
  • 3′ sequencing primer GGGCGGGGGTCGTTGGGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    University of Michigan Vector Core

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The original pCWB-CMV mCherry plasmid was provided by the University of Michigan Vector Core. We inserted a cloning site into the original plasmid that would enable the cloning of a U6 promoter-driven sgRNA into the backbone.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV sgRNA Expression Plasmid was a gift from Ormond MacDougald (Addgene plasmid # 174540 ; http://n2t.net/addgene:174540 ; RRID:Addgene_174540)
  • For your References section:

    BAd-CRISPR: inducible gene knockout in interscapular brown adipose tissue of adult mice. Romanelli SM, Lewis KT, Nishii A, Rupp AC, Li Z, Mori H, Schill RL, Learman BS, Rhodes CJ, MacDougald OA. J Biol Chem. 2021 Nov 11:101402. doi: 10.1016/j.jbc.2021.101402. 10.1016/j.jbc.2021.101402 PubMed 34774798