AAV sgRNA Expression Plasmid
(Plasmid
#174540)
-
Purpose(Empty Backbone) Contains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174540 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepCWB
- Backbone size (bp) 5067
-
Vector typeMammalian Expression, AAV
- Promoter CMV
-
Selectable markersmCherry
-
Tag
/ Fusion Protein
- None (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer tttcccatgattccttcata
- 3′ sequencing primer GGGCGGGGGTCGTTGGGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUniversity of Michigan Vector Core
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The original pCWB-CMV mCherry plasmid was provided by the University of Michigan Vector Core. We inserted a cloning site into the original plasmid that would enable the cloning of a U6 promoter-driven sgRNA into the backbone.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV sgRNA Expression Plasmid was a gift from Ormond MacDougald (Addgene plasmid # 174540 ; http://n2t.net/addgene:174540 ; RRID:Addgene_174540) -
For your References section:
BAd-CRISPR: inducible gene knockout in interscapular brown adipose tissue of adult mice. Romanelli SM, Lewis KT, Nishii A, Rupp AC, Li Z, Mori H, Schill RL, Learman BS, Rhodes CJ, MacDougald OA. J Biol Chem. 2021 Nov 11:101402. doi: 10.1016/j.jbc.2021.101402. 10.1016/j.jbc.2021.101402 PubMed 34774798