pETSXM2-pLacI-mtrCAB
(Plasmid
#174618)
-
PurposeBacterial expression of gene cluster mtrCAB from Shewanella oneidensis MR-1.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174618 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-28a
- Backbone size w/o insert (bp) 3903
- Total vector size (bp) 9060
-
Modifications to backboneWith pLacI for constitutive expression and RepB replication origin for Shewanella species.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemtrCAB
-
SpeciesSynthetic; Shewanella oneidensis MR-1
-
Insert Size (bp)3903
- Promoter pLacI
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site NdeI (unknown if destroyed)
- 5′ sequencing primer AAGAGCTCATGATGAACGCAAAAAAATCAAAAATCGCACTGCTGC
- 3′ sequencing primer tacatatgttagagcttgtagctcatactcagcattagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note MtrC starts at amino acid 75. Depositor confirms this is not a concern.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETSXM2-pLacI-mtrCAB was a gift from I-Son Ng (Addgene plasmid # 174618 ; http://n2t.net/addgene:174618 ; RRID:Addgene_174618) -
For your References section:
Turn on the Mtr pathway genes under pLacI promoter in Shewanella oneidensis MR-1. I-Son Ng , Yanlan Guo, Yunli Zhou, Jhe-Wei Wu, Shih-I Tan & Ying-Chen Yi. Bioresour. Bioprocess. 5, 35 (2018) 10.1186/s40643-018-0221-9