Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pETSXM2-pLacI-mtrCAB
(Plasmid #174618)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 174618 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET-28a
  • Backbone size w/o insert (bp) 3903
  • Total vector size (bp) 9060
  • Modifications to backbone
    With pLacI for constitutive expression and RepB replication origin for Shewanella species.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mtrCAB
  • Species
    Synthetic; Shewanella oneidensis MR-1
  • Insert Size (bp)
    3903
  • Promoter pLacI

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site NdeI (unknown if destroyed)
  • 5′ sequencing primer AAGAGCTCATGATGAACGCAAAAAAATCAAAAATCGCACTGCTGC
  • 3′ sequencing primer tacatatgttagagcttgtagctcatactcagcattagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note MtrC starts at amino acid 75. Depositor confirms this is not a concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETSXM2-pLacI-mtrCAB was a gift from I-Son Ng (Addgene plasmid # 174618 ; http://n2t.net/addgene:174618 ; RRID:Addgene_174618)
  • For your References section:

    Turn on the Mtr pathway genes under pLacI promoter in Shewanella oneidensis MR-1. I-Son Ng , Yanlan Guo, Yunli Zhou, Jhe-Wei Wu, Shih-I Tan & Ying-Chen Yi. Bioresour. Bioprocess. 5, 35 (2018) 10.1186/s40643-018-0221-9